mouse mrna&lncrna epitranscriptomic microarray (8x60k) Search Results


93
Miltenyi Biotec reafinitytm miltenyi biotec
Reafinitytm Miltenyi Biotec, supplied by Miltenyi Biotec, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/mouse+mrna%26lncrna+epitranscriptomic+microarray+%288x60k%29/pmc09756281__jitc___2022___005769supp001-1-96-97?v=Miltenyi+Biotec
Average 93 stars, based on 1 article reviews
reafinitytm miltenyi biotec - by Bioz Stars, 2026-07
93/100 stars
  Buy from Supplier

92
OriGene lenti orf clones kit
Lenti Orf Clones Kit, supplied by OriGene, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/mouse+mrna%26lncrna+epitranscriptomic+microarray+%288x60k%29/pm35563809-111-23-26?v=OriGene
Average 92 stars, based on 1 article reviews
lenti orf clones kit - by Bioz Stars, 2026-07
92/100 stars
  Buy from Supplier

91
OriGene plenti c mgfp
Plenti C Mgfp, supplied by OriGene, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/mouse+mrna%26lncrna+epitranscriptomic+microarray+%288x60k%29/pmc07307178-404-18-19?v=OriGene
Average 91 stars, based on 1 article reviews
plenti c mgfp - by Bioz Stars, 2026-07
91/100 stars
  Buy from Supplier

90
Becton Dickinson mouse mrna samples
Mouse Mrna Samples, supplied by Becton Dickinson, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/mouse+mrna%26lncrna+epitranscriptomic+microarray+%288x60k%29/10__1074_slash_jbc__m203053200-64-6-9?v=Becton+Dickinson
Average 90 stars, based on 1 article reviews
mouse mrna samples - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

90
TriLink human cgasdn mrna sequence with codon optimization for mouse
LNP characterization and THP1 activation. LNPs were prepared using OVA <t>mRNA,</t> GFP mRNA, and cGAS∆N mRNA. All LNPs prepared were similarly sized, with an effective diameter of around 100 nm ( A ) and relatively uniform with a polydispersity index of around 0.2 ( B ). ( C ) All mRNAs load to the LNPs at similar rates. cGAS∆N-LNPs activate THP1-Null2 cells when delivered at 1 µg/mL mRNA. ( D ) IP-10 secretion by THP1 cells was measured after 24 hours in culture with cGAS∆N-LNPs, OVA-LNPs, or GFP-LNPs. Error bars represent the standard deviation between triplicates. ( E ) CD40 median fluorescence intensity among live THP1 cells was assessed by flow cytometry 24 hours after treatment with LNPs. Error bars represent the standard error of the mean (SEM) in fluorescence intensity of cells expressing CD40. Comparisons between groups were completed using a one-way ANOVA with a Tukey post hoc test for multiple comparisons. ****P < 0.0001.
Human Cgasdn Mrna Sequence With Codon Optimization For Mouse, supplied by TriLink, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/mouse+mrna%26lncrna+epitranscriptomic+microarray+%288x60k%29/pmc10746235-2-0-12?v=TriLink
Average 90 stars, based on 1 article reviews
human cgasdn mrna sequence with codon optimization for mouse - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

90
CapitalBio Corporation agilent mouse mrna array
LNP characterization and THP1 activation. LNPs were prepared using OVA <t>mRNA,</t> GFP mRNA, and cGAS∆N mRNA. All LNPs prepared were similarly sized, with an effective diameter of around 100 nm ( A ) and relatively uniform with a polydispersity index of around 0.2 ( B ). ( C ) All mRNAs load to the LNPs at similar rates. cGAS∆N-LNPs activate THP1-Null2 cells when delivered at 1 µg/mL mRNA. ( D ) IP-10 secretion by THP1 cells was measured after 24 hours in culture with cGAS∆N-LNPs, OVA-LNPs, or GFP-LNPs. Error bars represent the standard deviation between triplicates. ( E ) CD40 median fluorescence intensity among live THP1 cells was assessed by flow cytometry 24 hours after treatment with LNPs. Error bars represent the standard error of the mean (SEM) in fluorescence intensity of cells expressing CD40. Comparisons between groups were completed using a one-way ANOVA with a Tukey post hoc test for multiple comparisons. ****P < 0.0001.
Agilent Mouse Mrna Array, supplied by CapitalBio Corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/mouse+mrna%26lncrna+epitranscriptomic+microarray+%288x60k%29/pm33664222-235-5-22?v=CapitalBio+Corporation
Average 90 stars, based on 1 article reviews
agilent mouse mrna array - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

90
Becton Dickinson mouse brain polya + mrna
LNP characterization and THP1 activation. LNPs were prepared using OVA <t>mRNA,</t> GFP mRNA, and cGAS∆N mRNA. All LNPs prepared were similarly sized, with an effective diameter of around 100 nm ( A ) and relatively uniform with a polydispersity index of around 0.2 ( B ). ( C ) All mRNAs load to the LNPs at similar rates. cGAS∆N-LNPs activate THP1-Null2 cells when delivered at 1 µg/mL mRNA. ( D ) IP-10 secretion by THP1 cells was measured after 24 hours in culture with cGAS∆N-LNPs, OVA-LNPs, or GFP-LNPs. Error bars represent the standard deviation between triplicates. ( E ) CD40 median fluorescence intensity among live THP1 cells was assessed by flow cytometry 24 hours after treatment with LNPs. Error bars represent the standard error of the mean (SEM) in fluorescence intensity of cells expressing CD40. Comparisons between groups were completed using a one-way ANOVA with a Tukey post hoc test for multiple comparisons. ****P < 0.0001.
Mouse Brain Polya + Mrna, supplied by Becton Dickinson, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/mouse+mrna%26lncrna+epitranscriptomic+microarray+%288x60k%29/pmc01369289-38-4-9?v=Becton+Dickinson
Average 90 stars, based on 1 article reviews
mouse brain polya + mrna - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

90
MRC-Holland apoptosis mouse mrna rtmlpa kit
LNP characterization and THP1 activation. LNPs were prepared using OVA <t>mRNA,</t> GFP mRNA, and cGAS∆N mRNA. All LNPs prepared were similarly sized, with an effective diameter of around 100 nm ( A ) and relatively uniform with a polydispersity index of around 0.2 ( B ). ( C ) All mRNAs load to the LNPs at similar rates. cGAS∆N-LNPs activate THP1-Null2 cells when delivered at 1 µg/mL mRNA. ( D ) IP-10 secretion by THP1 cells was measured after 24 hours in culture with cGAS∆N-LNPs, OVA-LNPs, or GFP-LNPs. Error bars represent the standard deviation between triplicates. ( E ) CD40 median fluorescence intensity among live THP1 cells was assessed by flow cytometry 24 hours after treatment with LNPs. Error bars represent the standard error of the mean (SEM) in fluorescence intensity of cells expressing CD40. Comparisons between groups were completed using a one-way ANOVA with a Tukey post hoc test for multiple comparisons. ****P < 0.0001.
Apoptosis Mouse Mrna Rtmlpa Kit, supplied by MRC-Holland, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/mouse+mrna%26lncrna+epitranscriptomic+microarray+%288x60k%29/pm22450812-54-7-12?v=MRC-Holland
Average 90 stars, based on 1 article reviews
apoptosis mouse mrna rtmlpa kit - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

90
Genentech inc mrna from mouse f9 teratocarcinoma cells
LNP characterization and THP1 activation. LNPs were prepared using OVA <t>mRNA,</t> GFP mRNA, and cGAS∆N mRNA. All LNPs prepared were similarly sized, with an effective diameter of around 100 nm ( A ) and relatively uniform with a polydispersity index of around 0.2 ( B ). ( C ) All mRNAs load to the LNPs at similar rates. cGAS∆N-LNPs activate THP1-Null2 cells when delivered at 1 µg/mL mRNA. ( D ) IP-10 secretion by THP1 cells was measured after 24 hours in culture with cGAS∆N-LNPs, OVA-LNPs, or GFP-LNPs. Error bars represent the standard deviation between triplicates. ( E ) CD40 median fluorescence intensity among live THP1 cells was assessed by flow cytometry 24 hours after treatment with LNPs. Error bars represent the standard error of the mean (SEM) in fluorescence intensity of cells expressing CD40. Comparisons between groups were completed using a one-way ANOVA with a Tukey post hoc test for multiple comparisons. ****P < 0.0001.
Mrna From Mouse F9 Teratocarcinoma Cells, supplied by Genentech inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/mouse+mrna%26lncrna+epitranscriptomic+microarray+%288x60k%29/pm15055586-21-35-7?v=Genentech+inc
Average 90 stars, based on 1 article reviews
mrna from mouse f9 teratocarcinoma cells - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

90
Broad Institute Inc sirna duplexes (21 nucleotides for sense and antisense) targeting the mouse ehmt2 mrna and human ehmt2 mrna
hsa, Homo sapiens; mmu, Mus musculus; R, reverse; F, forward.
Sirna Duplexes (21 Nucleotides For Sense And Antisense) Targeting The Mouse Ehmt2 Mrna And Human Ehmt2 Mrna, supplied by Broad Institute Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/mouse+mrna%26lncrna+epitranscriptomic+microarray+%288x60k%29/pmc11594117-84-15-26?v=Broad+Institute+Inc
Average 90 stars, based on 1 article reviews
sirna duplexes (21 nucleotides for sense and antisense) targeting the mouse ehmt2 mrna and human ehmt2 mrna - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

90
SIRION Biotech recombinant adenovirus comprising fragments of the mouse glis3 mrna
INS-1E cells, primary FACS-purified rat beta cells and human islet cells were transfected with control or <t>GLIS3</t> siRNA (siCTL and siGLIS3, respectively; siGLIS3 here and below refers always to the GLIS3 siRNA#1; different siRNAs were used for rat and human cells as shown in ). After 48 h, cells were used for real-time PCR analyses in INS-1E (A–E), primary rat beta cells (F–H), human islet cells (I) or functional studies (J–L). are means ± SEM corrected by the housekeeping genes GAPDH or β-actin (n = 4–5); (J) medium insulin accumulation of dispersed human islet cells; (K) glucose metabolism of INS-1E cells exposed to 1 or 10 mM glucose after GLIS3 KD (n = 6); (L) insulin secretion in INS-1E cells treated with 1 mM glucose, 10 mM glucose or 10 mM glucose plus forskolin (20 µM) after GLIS3 KD (n = 5). * P <0.05, ** P <0.01 and *** P <0.001 vs . siCTL by paired t -test.
Recombinant Adenovirus Comprising Fragments Of The Mouse Glis3 Mrna, supplied by SIRION Biotech, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/mouse+mrna%26lncrna+epitranscriptomic+microarray+%288x60k%29/pmc03667755-146-20-9?v=SIRION+Biotech
Average 90 stars, based on 1 article reviews
recombinant adenovirus comprising fragments of the mouse glis3 mrna - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

90
Microsynth ag synthetic dna oligonucleotides complementary to the mrna sequence of mouse stam2
INS-1E cells, primary FACS-purified rat beta cells and human islet cells were transfected with control or <t>GLIS3</t> siRNA (siCTL and siGLIS3, respectively; siGLIS3 here and below refers always to the GLIS3 siRNA#1; different siRNAs were used for rat and human cells as shown in ). After 48 h, cells were used for real-time PCR analyses in INS-1E (A–E), primary rat beta cells (F–H), human islet cells (I) or functional studies (J–L). are means ± SEM corrected by the housekeeping genes GAPDH or β-actin (n = 4–5); (J) medium insulin accumulation of dispersed human islet cells; (K) glucose metabolism of INS-1E cells exposed to 1 or 10 mM glucose after GLIS3 KD (n = 6); (L) insulin secretion in INS-1E cells treated with 1 mM glucose, 10 mM glucose or 10 mM glucose plus forskolin (20 µM) after GLIS3 KD (n = 5). * P <0.05, ** P <0.01 and *** P <0.001 vs . siCTL by paired t -test.
Synthetic Dna Oligonucleotides Complementary To The Mrna Sequence Of Mouse Stam2, supplied by Microsynth ag, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/mouse+mrna%26lncrna+epitranscriptomic+microarray+%288x60k%29/pm26101075-51-11-28?v=Microsynth+ag
Average 90 stars, based on 1 article reviews
synthetic dna oligonucleotides complementary to the mrna sequence of mouse stam2 - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

Image Search Results


LNP characterization and THP1 activation. LNPs were prepared using OVA mRNA, GFP mRNA, and cGAS∆N mRNA. All LNPs prepared were similarly sized, with an effective diameter of around 100 nm ( A ) and relatively uniform with a polydispersity index of around 0.2 ( B ). ( C ) All mRNAs load to the LNPs at similar rates. cGAS∆N-LNPs activate THP1-Null2 cells when delivered at 1 µg/mL mRNA. ( D ) IP-10 secretion by THP1 cells was measured after 24 hours in culture with cGAS∆N-LNPs, OVA-LNPs, or GFP-LNPs. Error bars represent the standard deviation between triplicates. ( E ) CD40 median fluorescence intensity among live THP1 cells was assessed by flow cytometry 24 hours after treatment with LNPs. Error bars represent the standard error of the mean (SEM) in fluorescence intensity of cells expressing CD40. Comparisons between groups were completed using a one-way ANOVA with a Tukey post hoc test for multiple comparisons. ****P < 0.0001.

Journal: mBio

Article Title: mRNAs encoding self-DNA reactive cGAS enhance the immunogenicity of lipid nanoparticle vaccines

doi: 10.1128/mbio.02506-23

Figure Lengend Snippet: LNP characterization and THP1 activation. LNPs were prepared using OVA mRNA, GFP mRNA, and cGAS∆N mRNA. All LNPs prepared were similarly sized, with an effective diameter of around 100 nm ( A ) and relatively uniform with a polydispersity index of around 0.2 ( B ). ( C ) All mRNAs load to the LNPs at similar rates. cGAS∆N-LNPs activate THP1-Null2 cells when delivered at 1 µg/mL mRNA. ( D ) IP-10 secretion by THP1 cells was measured after 24 hours in culture with cGAS∆N-LNPs, OVA-LNPs, or GFP-LNPs. Error bars represent the standard deviation between triplicates. ( E ) CD40 median fluorescence intensity among live THP1 cells was assessed by flow cytometry 24 hours after treatment with LNPs. Error bars represent the standard error of the mean (SEM) in fluorescence intensity of cells expressing CD40. Comparisons between groups were completed using a one-way ANOVA with a Tukey post hoc test for multiple comparisons. ****P < 0.0001.

Article Snippet: Human cGASDN mRNA sequence with codon optimization for mouse , AUGCCCGGCGCCAGCAAGCUGAGGGCCGUGCUGGAGAAGCUGAAGCUGAGCAGGGACGACAUCAGCACCGCCGCCGGCAUGGUGAAGGGCGUGGUGGACCACCUGCUGCUGAGGCUGAAGUGCGACAGCGCCUUCAGGGGCGUGGGCCUGCUGAACACCGGCAGCUACUACGAGCACGUGAAGAUCAGCGCCCCCAACGAGUUCGACGUGAUGUUCAAGCUGGAGGUGCCCAGGAUCCAGCUGGAGGAGUACAGCAACACCAGGGCCUACUACUUCGUGAAGUUCAAGAGGAACCCCAAGGAGAACCCCCUGAGCCAGUUCCUGGAGGGCGAGAUCCUGAGCGCCAGCAAGAUGCUGAGCAAGUUCAGGAAGAUCAUCAAGGAGGAGAUCAACGACAUCAAGGACACCGACGUGAUCAUGAAGAGGAAGAGGGGCGGCAGCCCCGCCGUGACCCUGCUGAUCAGCGAGAAGAUCAGCGUGGACAUCACCCUGGCCCUGGAGAGCAAGAGCAGCUGGCCCGCCAGCACCCAGGAGGGCCUGAGGAUCCAGAACUGGCUGAGCGCCAAGGUGAGGAAGCAGCUGAGGCUGAAGCCCUUCUACCUGGUGCCCAAGCACGCCAAGGAGGGCAACGGCUUCCAGGAGGAGACCUGGAGGCUGAGCUUCAGCCACAUCGAGAAGGAGAUCCUGAACAACCACGGCAAGAGCAAGACCUGCUGCGAGAACAAGGAGGAGAAGUGCUGCAGGAAGGACUGCCUGAAGCUGAUGAAGUACCUGCUGGAGCAGCUGAAGGAGAGGUUCAAGGACAAGAAGCACCUGGACAAGUUCAGCAGCUACCACGUGAAGACCGCCUUCUUCCACGUGUGCACCCAGAACCCCCAGGACAGCCAGUGGGACAGGAAGGACCUGGGCCUGUGCUUCGACAACUGCGUGACCUACUUCCUGCAGUGCCUGAGGACCGAGAAGCUGGAGAACUACUUCAUCCCCGAGUUCAACCUGUUCAGCAGCAACCUGAUCGACAAGAGGAGCAAGGAGUUCCUGACCAAGCAGAUCGAGUACGAGAGGAACAACGAGUUCCCCGUGUUCGACGAGUUCUAAUGA , TriLink , N/A.

Techniques: Activation Assay, Standard Deviation, Fluorescence, Flow Cytometry, Expressing

cGAS∆N-LNPs induce human moDC activation. Human moDCs were cultured for 24 hours in the presence of cGAS∆N-LNPs (0.2 µg/mL mRNA in well), GFP-LNPs (0.2 µg/mL mRNA in well), or OVA-LNPs (1.0 µg/mL mRNA in well). ( A ) IL-6, ( B ) IP-10, ( C ) and IFNβ secretion were assessed using a multiplex cytokine bead array. Data on graphs represent the average of a triplicate for each of the four donors. Error bars show the standard deviation between donor cytokine secretion. ( D ) cGAMP production was quantified from cell lysates following LNP treatments. Data represent means and SD of a triplicate from one donor. Data are representative of at least two donors. ( E–H ) MoDCs were cultured in the presence of cGAS∆N-LNPs with or without pre-treatment with TBK1 inhibitor or STING inhibitor for 24 hours. ( E ) Heat map representing normalized cytokine secretion post-treatment of one donor. ( F ) IP-10 and ( G ) IFNβ secretion was measured, and data represent the average of a triplicate from one donor. Data are representative of at least two donors. ( H ) Cells treated for 24 hours in the presence of cGAS∆N-LNPs were stained for activation markers. The MFI of CD40 expression was quantified by flow cytometry. Data represent the MFI for each of the two donors run in triplicate. Error bars show the standard deviation between donor surface marker expressions. Comparisons between groups were completed using a one-way ANOVA with a Tukey post hoc test for multiple comparisons. *P < 0.05, **P < 0.01, ***P < 0.001, and ****P < 0.0001.

Journal: mBio

Article Title: mRNAs encoding self-DNA reactive cGAS enhance the immunogenicity of lipid nanoparticle vaccines

doi: 10.1128/mbio.02506-23

Figure Lengend Snippet: cGAS∆N-LNPs induce human moDC activation. Human moDCs were cultured for 24 hours in the presence of cGAS∆N-LNPs (0.2 µg/mL mRNA in well), GFP-LNPs (0.2 µg/mL mRNA in well), or OVA-LNPs (1.0 µg/mL mRNA in well). ( A ) IL-6, ( B ) IP-10, ( C ) and IFNβ secretion were assessed using a multiplex cytokine bead array. Data on graphs represent the average of a triplicate for each of the four donors. Error bars show the standard deviation between donor cytokine secretion. ( D ) cGAMP production was quantified from cell lysates following LNP treatments. Data represent means and SD of a triplicate from one donor. Data are representative of at least two donors. ( E–H ) MoDCs were cultured in the presence of cGAS∆N-LNPs with or without pre-treatment with TBK1 inhibitor or STING inhibitor for 24 hours. ( E ) Heat map representing normalized cytokine secretion post-treatment of one donor. ( F ) IP-10 and ( G ) IFNβ secretion was measured, and data represent the average of a triplicate from one donor. Data are representative of at least two donors. ( H ) Cells treated for 24 hours in the presence of cGAS∆N-LNPs were stained for activation markers. The MFI of CD40 expression was quantified by flow cytometry. Data represent the MFI for each of the two donors run in triplicate. Error bars show the standard deviation between donor surface marker expressions. Comparisons between groups were completed using a one-way ANOVA with a Tukey post hoc test for multiple comparisons. *P < 0.05, **P < 0.01, ***P < 0.001, and ****P < 0.0001.

Article Snippet: Human cGASDN mRNA sequence with codon optimization for mouse , AUGCCCGGCGCCAGCAAGCUGAGGGCCGUGCUGGAGAAGCUGAAGCUGAGCAGGGACGACAUCAGCACCGCCGCCGGCAUGGUGAAGGGCGUGGUGGACCACCUGCUGCUGAGGCUGAAGUGCGACAGCGCCUUCAGGGGCGUGGGCCUGCUGAACACCGGCAGCUACUACGAGCACGUGAAGAUCAGCGCCCCCAACGAGUUCGACGUGAUGUUCAAGCUGGAGGUGCCCAGGAUCCAGCUGGAGGAGUACAGCAACACCAGGGCCUACUACUUCGUGAAGUUCAAGAGGAACCCCAAGGAGAACCCCCUGAGCCAGUUCCUGGAGGGCGAGAUCCUGAGCGCCAGCAAGAUGCUGAGCAAGUUCAGGAAGAUCAUCAAGGAGGAGAUCAACGACAUCAAGGACACCGACGUGAUCAUGAAGAGGAAGAGGGGCGGCAGCCCCGCCGUGACCCUGCUGAUCAGCGAGAAGAUCAGCGUGGACAUCACCCUGGCCCUGGAGAGCAAGAGCAGCUGGCCCGCCAGCACCCAGGAGGGCCUGAGGAUCCAGAACUGGCUGAGCGCCAAGGUGAGGAAGCAGCUGAGGCUGAAGCCCUUCUACCUGGUGCCCAAGCACGCCAAGGAGGGCAACGGCUUCCAGGAGGAGACCUGGAGGCUGAGCUUCAGCCACAUCGAGAAGGAGAUCCUGAACAACCACGGCAAGAGCAAGACCUGCUGCGAGAACAAGGAGGAGAAGUGCUGCAGGAAGGACUGCCUGAAGCUGAUGAAGUACCUGCUGGAGCAGCUGAAGGAGAGGUUCAAGGACAAGAAGCACCUGGACAAGUUCAGCAGCUACCACGUGAAGACCGCCUUCUUCCACGUGUGCACCCAGAACCCCCAGGACAGCCAGUGGGACAGGAAGGACCUGGGCCUGUGCUUCGACAACUGCGUGACCUACUUCCUGCAGUGCCUGAGGACCGAGAAGCUGGAGAACUACUUCAUCCCCGAGUUCAACCUGUUCAGCAGCAACCUGAUCGACAAGAGGAGCAAGGAGUUCCUGACCAAGCAGAUCGAGUACGAGAGGAACAACGAGUUCCCCGUGUUCGACGAGUUCUAAUGA , TriLink , N/A.

Techniques: Activation Assay, Cell Culture, Multiplex Assay, Standard Deviation, Staining, Expressing, Flow Cytometry, Marker

 mRNA  sequence used

Journal: mBio

Article Title: mRNAs encoding self-DNA reactive cGAS enhance the immunogenicity of lipid nanoparticle vaccines

doi: 10.1128/mbio.02506-23

Figure Lengend Snippet: mRNA sequence used

Article Snippet: Human cGASDN mRNA sequence with codon optimization for mouse , AUGCCCGGCGCCAGCAAGCUGAGGGCCGUGCUGGAGAAGCUGAAGCUGAGCAGGGACGACAUCAGCACCGCCGCCGGCAUGGUGAAGGGCGUGGUGGACCACCUGCUGCUGAGGCUGAAGUGCGACAGCGCCUUCAGGGGCGUGGGCCUGCUGAACACCGGCAGCUACUACGAGCACGUGAAGAUCAGCGCCCCCAACGAGUUCGACGUGAUGUUCAAGCUGGAGGUGCCCAGGAUCCAGCUGGAGGAGUACAGCAACACCAGGGCCUACUACUUCGUGAAGUUCAAGAGGAACCCCAAGGAGAACCCCCUGAGCCAGUUCCUGGAGGGCGAGAUCCUGAGCGCCAGCAAGAUGCUGAGCAAGUUCAGGAAGAUCAUCAAGGAGGAGAUCAACGACAUCAAGGACACCGACGUGAUCAUGAAGAGGAAGAGGGGCGGCAGCCCCGCCGUGACCCUGCUGAUCAGCGAGAAGAUCAGCGUGGACAUCACCCUGGCCCUGGAGAGCAAGAGCAGCUGGCCCGCCAGCACCCAGGAGGGCCUGAGGAUCCAGAACUGGCUGAGCGCCAAGGUGAGGAAGCAGCUGAGGCUGAAGCCCUUCUACCUGGUGCCCAAGCACGCCAAGGAGGGCAACGGCUUCCAGGAGGAGACCUGGAGGCUGAGCUUCAGCCACAUCGAGAAGGAGAUCCUGAACAACCACGGCAAGAGCAAGACCUGCUGCGAGAACAAGGAGGAGAAGUGCUGCAGGAAGGACUGCCUGAAGCUGAUGAAGUACCUGCUGGAGCAGCUGAAGGAGAGGUUCAAGGACAAGAAGCACCUGGACAAGUUCAGCAGCUACCACGUGAAGACCGCCUUCUUCCACGUGUGCACCCAGAACCCCCAGGACAGCCAGUGGGACAGGAAGGACCUGGGCCUGUGCUUCGACAACUGCGUGACCUACUUCCUGCAGUGCCUGAGGACCGAGAAGCUGGAGAACUACUUCAUCCCCGAGUUCAACCUGUUCAGCAGCAACCUGAUCGACAAGAGGAGCAAGGAGUUCCUGACCAAGCAGAUCGAGUACGAGAGGAACAACGAGUUCCCCGUGUUCGACGAGUUCUAAUGA , TriLink , N/A.

Techniques: Sequencing

hsa, Homo sapiens; mmu, Mus musculus; R, reverse; F, forward.

Journal: Genes

Article Title: RNAi Knockdown of EHMT2 in Maternal Expression of Prader–Willi Syndrome Genes

doi: 10.3390/genes15111366

Figure Lengend Snippet: hsa, Homo sapiens; mmu, Mus musculus; R, reverse; F, forward.

Article Snippet: Several siRNA duplexes (21 nucleotides for sense and antisense) targeting the mouse Ehmt2 mRNA and human EHMT2 mRNA were designed using The Genetic Perturbation Platform from Broad Institute.

Techniques: Sequencing

Efficacy of EHMT2 transcript reduction with specific siRNAs in human UPD patient-derived iPSCs. ( a ). Gene expression of EHMT2 in PWS UPD iPSCs following transfection with control siRNAs (UNC) or specific siRNAs targeting EHMT2 . A significant reduction in EHMT2 was observed with all the siRNA candidates relative to the control; ( b ) quantification of the EHMT2 protein in UPD iPSCs treated with siRNA targeting EHMT2 and compared to treated cells with the control siRNA UNC; ( c ) representative image of EHMT2 protein from UPD iPSCs treated with siRNA candidates analyzed by Western blotting; ( d ) gene expression of SNRPN and ( e ) gene expression of SNORD116 in PWS UPD iPSCs following transfection with control siRNAs (UNC) or specific siRNAs targeting EHMT2 . EIF4A2 was used as a control. Student’s t test: *, p < 0.05; **, p < 0.01; ***, p < 0.001; ****, p < 0.0001; data represent means ± S.E.M (N = 3–4).

Journal: Genes

Article Title: RNAi Knockdown of EHMT2 in Maternal Expression of Prader–Willi Syndrome Genes

doi: 10.3390/genes15111366

Figure Lengend Snippet: Efficacy of EHMT2 transcript reduction with specific siRNAs in human UPD patient-derived iPSCs. ( a ). Gene expression of EHMT2 in PWS UPD iPSCs following transfection with control siRNAs (UNC) or specific siRNAs targeting EHMT2 . A significant reduction in EHMT2 was observed with all the siRNA candidates relative to the control; ( b ) quantification of the EHMT2 protein in UPD iPSCs treated with siRNA targeting EHMT2 and compared to treated cells with the control siRNA UNC; ( c ) representative image of EHMT2 protein from UPD iPSCs treated with siRNA candidates analyzed by Western blotting; ( d ) gene expression of SNRPN and ( e ) gene expression of SNORD116 in PWS UPD iPSCs following transfection with control siRNAs (UNC) or specific siRNAs targeting EHMT2 . EIF4A2 was used as a control. Student’s t test: *, p < 0.05; **, p < 0.01; ***, p < 0.001; ****, p < 0.0001; data represent means ± S.E.M (N = 3–4).

Article Snippet: Several siRNA duplexes (21 nucleotides for sense and antisense) targeting the mouse Ehmt2 mRNA and human EHMT2 mRNA were designed using The Genetic Perturbation Platform from Broad Institute.

Techniques: Derivative Assay, Expressing, Transfection, Control, Western Blot

Efficacy of Ehmt2 transcript reduction with specific siRNAs in mouse primary neurons. ( a ) Gene expression of Ehmt2 in primary neurons from Snord116 p−/m+ mice following transfection with control siRNAs (UNC) or specific siRNAs targeting Ehmt2 . A significant reduction in Ehmt2 was observed with all the siRNA candidates relative to the control; ( b ) gene expression of Snord116HG following transfection with control siRNAs (UNC) or specific siRNAs targeting Ehmt2 . Eif4a2 was used as a control. Student’s t test: ****, p < 0.0001; data represent means ± S.E.M from four biological replicates.

Journal: Genes

Article Title: RNAi Knockdown of EHMT2 in Maternal Expression of Prader–Willi Syndrome Genes

doi: 10.3390/genes15111366

Figure Lengend Snippet: Efficacy of Ehmt2 transcript reduction with specific siRNAs in mouse primary neurons. ( a ) Gene expression of Ehmt2 in primary neurons from Snord116 p−/m+ mice following transfection with control siRNAs (UNC) or specific siRNAs targeting Ehmt2 . A significant reduction in Ehmt2 was observed with all the siRNA candidates relative to the control; ( b ) gene expression of Snord116HG following transfection with control siRNAs (UNC) or specific siRNAs targeting Ehmt2 . Eif4a2 was used as a control. Student’s t test: ****, p < 0.0001; data represent means ± S.E.M from four biological replicates.

Article Snippet: Several siRNA duplexes (21 nucleotides for sense and antisense) targeting the mouse Ehmt2 mRNA and human EHMT2 mRNA were designed using The Genetic Perturbation Platform from Broad Institute.

Techniques: Expressing, Transfection, Control

Expression levels of EHMT2 , SNRPN , and SNORD116 after transfection with U6 anti- EHMT2 shRNA DNA plasmids: ( a ) HEK293 cells were transfected with a plasmid construct control (shRNA Scramble) and shRNA specifically targeting EHMT2 . A significant reduction in EHMT2 expression was observed with all the shRNA plasmid candidates relative to the control; ( b ) PWS UPD iPSC was transfected with the plasmid control and shRNA targeting EHMT2 . A moderate but significant reduction in EHMT2 expression was observed 72 h post transfection; ( c ) SNRPN and SNORD116 expression levels in PWS UPD iPSC remained at the same level as for the control after transfection with U6shRNA plasmids targeting EHTM2 . Student’s t test: *, p < 0.05; ***, p < 0.001; ****, p < 0.0001; data represent the means ± S.E.M from three biological replicates.

Journal: Genes

Article Title: RNAi Knockdown of EHMT2 in Maternal Expression of Prader–Willi Syndrome Genes

doi: 10.3390/genes15111366

Figure Lengend Snippet: Expression levels of EHMT2 , SNRPN , and SNORD116 after transfection with U6 anti- EHMT2 shRNA DNA plasmids: ( a ) HEK293 cells were transfected with a plasmid construct control (shRNA Scramble) and shRNA specifically targeting EHMT2 . A significant reduction in EHMT2 expression was observed with all the shRNA plasmid candidates relative to the control; ( b ) PWS UPD iPSC was transfected with the plasmid control and shRNA targeting EHMT2 . A moderate but significant reduction in EHMT2 expression was observed 72 h post transfection; ( c ) SNRPN and SNORD116 expression levels in PWS UPD iPSC remained at the same level as for the control after transfection with U6shRNA plasmids targeting EHTM2 . Student’s t test: *, p < 0.05; ***, p < 0.001; ****, p < 0.0001; data represent the means ± S.E.M from three biological replicates.

Article Snippet: Several siRNA duplexes (21 nucleotides for sense and antisense) targeting the mouse Ehmt2 mRNA and human EHMT2 mRNA were designed using The Genetic Perturbation Platform from Broad Institute.

Techniques: Expressing, Transfection, shRNA, Plasmid Preparation, Construct, Control

Expression levels of EHMT2 , SNRPN and SNORD116 in UPD iPSC-derived neurons transduced with lentivirus containing anti- EHMT2 shRNA or control (Scramble): ( a ) NILV-U6shRNA(h EHMT2 /m Ehmt2 -14) significantly reduced EHMT2 RNA levels as opposed to a mild reduction with NILV-U6shRNA (h EHMT2 /m Ehmt2 -11) 7 days post transduction; EHMT2 expression is further reduced 14 days post transduction with NILV-U6shRNA (h EHMT2 /m Ehmt2 -11). ( b ) NILV-U6shRNA (h EHMT2 /m Ehmt2 -11) significantly increased SNRPN and SNORD116 transcript levels 7 days post transduction, as opposed to no change 14 days post transduction. There is a significant increase in SNRPN transcripts levels without any change in SNORD116 transcripts levels 7 days post transduction with NILV-U6shRNA (h EHMT2 /m Ehmt2 -14). Student’s t test: *, p < 0.05; **, p < 0.01; ***, p < 0.001; ****, p < 0.0001; ns, p > 0.05; data represent the means ± S.E.M of four biological replicates.

Journal: Genes

Article Title: RNAi Knockdown of EHMT2 in Maternal Expression of Prader–Willi Syndrome Genes

doi: 10.3390/genes15111366

Figure Lengend Snippet: Expression levels of EHMT2 , SNRPN and SNORD116 in UPD iPSC-derived neurons transduced with lentivirus containing anti- EHMT2 shRNA or control (Scramble): ( a ) NILV-U6shRNA(h EHMT2 /m Ehmt2 -14) significantly reduced EHMT2 RNA levels as opposed to a mild reduction with NILV-U6shRNA (h EHMT2 /m Ehmt2 -11) 7 days post transduction; EHMT2 expression is further reduced 14 days post transduction with NILV-U6shRNA (h EHMT2 /m Ehmt2 -11). ( b ) NILV-U6shRNA (h EHMT2 /m Ehmt2 -11) significantly increased SNRPN and SNORD116 transcript levels 7 days post transduction, as opposed to no change 14 days post transduction. There is a significant increase in SNRPN transcripts levels without any change in SNORD116 transcripts levels 7 days post transduction with NILV-U6shRNA (h EHMT2 /m Ehmt2 -14). Student’s t test: *, p < 0.05; **, p < 0.01; ***, p < 0.001; ****, p < 0.0001; ns, p > 0.05; data represent the means ± S.E.M of four biological replicates.

Article Snippet: Several siRNA duplexes (21 nucleotides for sense and antisense) targeting the mouse Ehmt2 mRNA and human EHMT2 mRNA were designed using The Genetic Perturbation Platform from Broad Institute.

Techniques: Expressing, Derivative Assay, Transduction, shRNA, Control

Expression levels of EHMT2, MAGEL2, SNRPN , and SNORD116 in SD-iPSC-derived neurons transduced with lentivirus with shRNA targeting EHMT2 and control (Scramble): ( a ) NILV-U6shRNA(h EHMT2 /m Ehmt2 -14) and NILV-U6shRNA (h EHMT2 /m Ehmt2 -11) significantly reduced EHMT2 RNA levels 7 days post transduction as opposed to a milder reduction 21 days post transduction; ( b ) NILV-U6shRNA (h EHMT2 /m Ehmt2 -11) significantly increased SNRPN transcript levels 7 days and 21 days post transduction as opposed to no change in SNRPN transcript levels 7 days and 21 days post transduction with NILV-U6shRNA(h EHMT2 /m Ehmt2 -14). A significant increase in SNORD116 transcripts levels is shown at day 7 post transduction with NILV-U6shRNA (h EHMT2 /m Ehmt2 -11). Student’s t test; *, p < 0.05; **, p < 0.01; ****, p < 0.0001; ns, p > 0.05; data represent the means ± S.E.M from four biological replicates.

Journal: Genes

Article Title: RNAi Knockdown of EHMT2 in Maternal Expression of Prader–Willi Syndrome Genes

doi: 10.3390/genes15111366

Figure Lengend Snippet: Expression levels of EHMT2, MAGEL2, SNRPN , and SNORD116 in SD-iPSC-derived neurons transduced with lentivirus with shRNA targeting EHMT2 and control (Scramble): ( a ) NILV-U6shRNA(h EHMT2 /m Ehmt2 -14) and NILV-U6shRNA (h EHMT2 /m Ehmt2 -11) significantly reduced EHMT2 RNA levels 7 days post transduction as opposed to a milder reduction 21 days post transduction; ( b ) NILV-U6shRNA (h EHMT2 /m Ehmt2 -11) significantly increased SNRPN transcript levels 7 days and 21 days post transduction as opposed to no change in SNRPN transcript levels 7 days and 21 days post transduction with NILV-U6shRNA(h EHMT2 /m Ehmt2 -14). A significant increase in SNORD116 transcripts levels is shown at day 7 post transduction with NILV-U6shRNA (h EHMT2 /m Ehmt2 -11). Student’s t test; *, p < 0.05; **, p < 0.01; ****, p < 0.0001; ns, p > 0.05; data represent the means ± S.E.M from four biological replicates.

Article Snippet: Several siRNA duplexes (21 nucleotides for sense and antisense) targeting the mouse Ehmt2 mRNA and human EHMT2 mRNA were designed using The Genetic Perturbation Platform from Broad Institute.

Techniques: Expressing, Derivative Assay, Transduction, shRNA, Control

INS-1E cells, primary FACS-purified rat beta cells and human islet cells were transfected with control or GLIS3 siRNA (siCTL and siGLIS3, respectively; siGLIS3 here and below refers always to the GLIS3 siRNA#1; different siRNAs were used for rat and human cells as shown in ). After 48 h, cells were used for real-time PCR analyses in INS-1E (A–E), primary rat beta cells (F–H), human islet cells (I) or functional studies (J–L). are means ± SEM corrected by the housekeeping genes GAPDH or β-actin (n = 4–5); (J) medium insulin accumulation of dispersed human islet cells; (K) glucose metabolism of INS-1E cells exposed to 1 or 10 mM glucose after GLIS3 KD (n = 6); (L) insulin secretion in INS-1E cells treated with 1 mM glucose, 10 mM glucose or 10 mM glucose plus forskolin (20 µM) after GLIS3 KD (n = 5). * P <0.05, ** P <0.01 and *** P <0.001 vs . siCTL by paired t -test.

Journal: PLoS Genetics

Article Title: GLIS3 , a Susceptibility Gene for Type 1 and Type 2 Diabetes, Modulates Pancreatic Beta Cell Apoptosis via Regulation of a Splice Variant of the BH3-Only Protein Bim

doi: 10.1371/journal.pgen.1003532

Figure Lengend Snippet: INS-1E cells, primary FACS-purified rat beta cells and human islet cells were transfected with control or GLIS3 siRNA (siCTL and siGLIS3, respectively; siGLIS3 here and below refers always to the GLIS3 siRNA#1; different siRNAs were used for rat and human cells as shown in ). After 48 h, cells were used for real-time PCR analyses in INS-1E (A–E), primary rat beta cells (F–H), human islet cells (I) or functional studies (J–L). are means ± SEM corrected by the housekeeping genes GAPDH or β-actin (n = 4–5); (J) medium insulin accumulation of dispersed human islet cells; (K) glucose metabolism of INS-1E cells exposed to 1 or 10 mM glucose after GLIS3 KD (n = 6); (L) insulin secretion in INS-1E cells treated with 1 mM glucose, 10 mM glucose or 10 mM glucose plus forskolin (20 µM) after GLIS3 KD (n = 5). * P <0.05, ** P <0.01 and *** P <0.001 vs . siCTL by paired t -test.

Article Snippet: To express GLIS3 in insulin-secreting cells, we obtained from SIRION Biotech (Munich, Germany) a recombinant adenovirus comprising fragments of the mouse GLIS3 mRNA (GenBank: NM_175459).

Techniques: Purification, Transfection, Control, Real-time Polymerase Chain Reaction, Functional Assay

Following transfection with siCTL and siGLIS3 as in , INS-1E cells (A, B, E–H) and human islet cells (C, D) were exposed to cytokines (A, B, C, D) (n = 4–7), PIC (E, F) (n = 7), oleate or palmitate (G, H) (n = 5). After 24 h GLIS3 mRNA expression and apoptosis were evaluated. are means ± SEM. * P <0.05, ** P <0.01 or *** P <0.001 vs . siCTL by paired t -test.

Journal: PLoS Genetics

Article Title: GLIS3 , a Susceptibility Gene for Type 1 and Type 2 Diabetes, Modulates Pancreatic Beta Cell Apoptosis via Regulation of a Splice Variant of the BH3-Only Protein Bim

doi: 10.1371/journal.pgen.1003532

Figure Lengend Snippet: Following transfection with siCTL and siGLIS3 as in , INS-1E cells (A, B, E–H) and human islet cells (C, D) were exposed to cytokines (A, B, C, D) (n = 4–7), PIC (E, F) (n = 7), oleate or palmitate (G, H) (n = 5). After 24 h GLIS3 mRNA expression and apoptosis were evaluated. are means ± SEM. * P <0.05, ** P <0.01 or *** P <0.001 vs . siCTL by paired t -test.

Article Snippet: To express GLIS3 in insulin-secreting cells, we obtained from SIRION Biotech (Munich, Germany) a recombinant adenovirus comprising fragments of the mouse GLIS3 mRNA (GenBank: NM_175459).

Techniques: Transfection, Expressing

INS-1E cells were transfected with control or GLIS3 siRNA. After 48 h cells were incubated with cytokines and collected at different time points for Western blot analyses. Representative blots (A) and densitometry (B, C) of Bcl-2 and Bcl-xL protein expression normalized by the housekeeping protein α-tubulin. are means ± SEM (n = 4).

Journal: PLoS Genetics

Article Title: GLIS3 , a Susceptibility Gene for Type 1 and Type 2 Diabetes, Modulates Pancreatic Beta Cell Apoptosis via Regulation of a Splice Variant of the BH3-Only Protein Bim

doi: 10.1371/journal.pgen.1003532

Figure Lengend Snippet: INS-1E cells were transfected with control or GLIS3 siRNA. After 48 h cells were incubated with cytokines and collected at different time points for Western blot analyses. Representative blots (A) and densitometry (B, C) of Bcl-2 and Bcl-xL protein expression normalized by the housekeeping protein α-tubulin. are means ± SEM (n = 4).

Article Snippet: To express GLIS3 in insulin-secreting cells, we obtained from SIRION Biotech (Munich, Germany) a recombinant adenovirus comprising fragments of the mouse GLIS3 mRNA (GenBank: NM_175459).

Techniques: Transfection, Control, Incubation, Western Blot, Expressing

INS-1E (A–E, G) and human dispersed islet cells (F) were transfected with control or GLIS3 siRNA. After 48 h human islets were collected for real-time analysis and INS-1E cells were incubated with cytokines (A–E) or palmitate (G) and collected at different time points for Western blot or real-time PCR analyses. mRNA expression of GLIS3 (A) and Bim (B) after GLIS3 KD; (C) representative blot (n = 4) of the expression of the protein isoforms Bim EL (extra-large), Bim L (large) and Bim S (small); (D) densitometry of Bim S expression normalized by the housekeeping protein α-tubulin; (E, F and G) mRNA expression of Bim S after GLIS3 KD in INS-1E cells and exposure to cytokines (E) or palmitate (G) or in human dispersed islet cells under basal conditions (F). are means ± SEM (n = 4). * P <0.05, ** P <0.01 and *** P <0.001 vs . siCTL. Paired t -test.

Journal: PLoS Genetics

Article Title: GLIS3 , a Susceptibility Gene for Type 1 and Type 2 Diabetes, Modulates Pancreatic Beta Cell Apoptosis via Regulation of a Splice Variant of the BH3-Only Protein Bim

doi: 10.1371/journal.pgen.1003532

Figure Lengend Snippet: INS-1E (A–E, G) and human dispersed islet cells (F) were transfected with control or GLIS3 siRNA. After 48 h human islets were collected for real-time analysis and INS-1E cells were incubated with cytokines (A–E) or palmitate (G) and collected at different time points for Western blot or real-time PCR analyses. mRNA expression of GLIS3 (A) and Bim (B) after GLIS3 KD; (C) representative blot (n = 4) of the expression of the protein isoforms Bim EL (extra-large), Bim L (large) and Bim S (small); (D) densitometry of Bim S expression normalized by the housekeeping protein α-tubulin; (E, F and G) mRNA expression of Bim S after GLIS3 KD in INS-1E cells and exposure to cytokines (E) or palmitate (G) or in human dispersed islet cells under basal conditions (F). are means ± SEM (n = 4). * P <0.05, ** P <0.01 and *** P <0.001 vs . siCTL. Paired t -test.

Article Snippet: To express GLIS3 in insulin-secreting cells, we obtained from SIRION Biotech (Munich, Germany) a recombinant adenovirus comprising fragments of the mouse GLIS3 mRNA (GenBank: NM_175459).

Techniques: Transfection, Control, Incubation, Western Blot, Real-time Polymerase Chain Reaction, Expressing

INS-1E cells (A, D and E), primary rat beta cells (B) and human dispersed islet cells (C) transfected with control or GLIS3 siRNAs were exposed to cytokines (A, B, C and D) or palmitate (E) for 24 h. (A, B, C and E) cells transfected with Bim siRNA (siBim); (D) cells transfected with a second Bim siRNA affecting preferentially Bim S (siBim S ). Apoptosis was then measured using nuclear dyes. are means ± SEM (n = 4–11). * P <0.05, ** P <0.01 or *** P <0.001 vs . siCTL without cytokines; ## P <0.01 or ### P <0.001 vs . siGLIS3; & P <0.05 or &&& P <0.001 vs . siBim; +++ P <0.001 vs . siGLIS3 + siBim; $ P <0.05, $$ P <0.01 or $$$ P <0.001 as indicated by the bars. ANOVA followed by paired t -test with Bonferroni's correction.

Journal: PLoS Genetics

Article Title: GLIS3 , a Susceptibility Gene for Type 1 and Type 2 Diabetes, Modulates Pancreatic Beta Cell Apoptosis via Regulation of a Splice Variant of the BH3-Only Protein Bim

doi: 10.1371/journal.pgen.1003532

Figure Lengend Snippet: INS-1E cells (A, D and E), primary rat beta cells (B) and human dispersed islet cells (C) transfected with control or GLIS3 siRNAs were exposed to cytokines (A, B, C and D) or palmitate (E) for 24 h. (A, B, C and E) cells transfected with Bim siRNA (siBim); (D) cells transfected with a second Bim siRNA affecting preferentially Bim S (siBim S ). Apoptosis was then measured using nuclear dyes. are means ± SEM (n = 4–11). * P <0.05, ** P <0.01 or *** P <0.001 vs . siCTL without cytokines; ## P <0.01 or ### P <0.001 vs . siGLIS3; & P <0.05 or &&& P <0.001 vs . siBim; +++ P <0.001 vs . siGLIS3 + siBim; $ P <0.05, $$ P <0.01 or $$$ P <0.001 as indicated by the bars. ANOVA followed by paired t -test with Bonferroni's correction.

Article Snippet: To express GLIS3 in insulin-secreting cells, we obtained from SIRION Biotech (Munich, Germany) a recombinant adenovirus comprising fragments of the mouse GLIS3 mRNA (GenBank: NM_175459).

Techniques: Transfection, Control

INS-1E cells were transfected with control, GLIS3 (A), SRp55 (B, C, D and E) and Bim S siRNAs (E). After 48 h cells were incubated with cytokines (C–E) for measuring apoptosis and collected at different time points for real-time PCR analyses. (A) Representative blot of 2 independent experiments for SRp55 protein expression after GLIS3 KD (n = 7; densitometry is provided in ); (B) SRp55 mRNA expression after KD with two different siRNAs (SRp55#1 and SRp55#2); (C) mRNA expression of Bim S after SRp55 KD and exposure to cytokines; (D, E) apoptosis in cells transfected with SRp55 and/or a Bim siRNA targeting preferentially Bim S (siBim S ). Apoptosis was measured using nuclear dyes. are means ± SEM (n = 4–7). * P <0.05, ** P <0.01, *** P <0.001 vs . siCTL without cytokines @@@ P <0.001 vs . siSRp55#1; ### P <0.001 vs . siSRp55#2; &&& P <0.001 vs . siBim S ; +++ P <0.001 vs . siSRp55 + siBim S ; $ P <0.05 or $$ P <0.01 as indicated by the bars. Paired t- test (7B and 7C) or ANOVA followed by paired t -test with Bonferroni's correction (7D and 7E).

Journal: PLoS Genetics

Article Title: GLIS3 , a Susceptibility Gene for Type 1 and Type 2 Diabetes, Modulates Pancreatic Beta Cell Apoptosis via Regulation of a Splice Variant of the BH3-Only Protein Bim

doi: 10.1371/journal.pgen.1003532

Figure Lengend Snippet: INS-1E cells were transfected with control, GLIS3 (A), SRp55 (B, C, D and E) and Bim S siRNAs (E). After 48 h cells were incubated with cytokines (C–E) for measuring apoptosis and collected at different time points for real-time PCR analyses. (A) Representative blot of 2 independent experiments for SRp55 protein expression after GLIS3 KD (n = 7; densitometry is provided in ); (B) SRp55 mRNA expression after KD with two different siRNAs (SRp55#1 and SRp55#2); (C) mRNA expression of Bim S after SRp55 KD and exposure to cytokines; (D, E) apoptosis in cells transfected with SRp55 and/or a Bim siRNA targeting preferentially Bim S (siBim S ). Apoptosis was measured using nuclear dyes. are means ± SEM (n = 4–7). * P <0.05, ** P <0.01, *** P <0.001 vs . siCTL without cytokines @@@ P <0.001 vs . siSRp55#1; ### P <0.001 vs . siSRp55#2; &&& P <0.001 vs . siBim S ; +++ P <0.001 vs . siSRp55 + siBim S ; $ P <0.05 or $$ P <0.01 as indicated by the bars. Paired t- test (7B and 7C) or ANOVA followed by paired t -test with Bonferroni's correction (7D and 7E).

Article Snippet: To express GLIS3 in insulin-secreting cells, we obtained from SIRION Biotech (Munich, Germany) a recombinant adenovirus comprising fragments of the mouse GLIS3 mRNA (GenBank: NM_175459).

Techniques: Transfection, Control, Incubation, Real-time Polymerase Chain Reaction, Expressing

INS-1E cells transfected with control or GLIS3 siRNA were exposed to forskolin (20 µM) and/or cytokines for 24 h. After this period apoptosis was measured using nuclear dyes. (A) Apoptosis induced by cytokine treatment after siRNA transfection and forskolin exposure. are means ± SEM (n = 6) * P <0.05 or *** P <0.001 vs . siCTL without forskolin; ### P <0.001 vs . siGLIS3 without forskolin; %% P <0.01 vs . siCTL with forskolin; @@@ P <0.001 vs . siGLIS3 with forskolin; $ P <0.05, $$ P <0.01, $$$ P <0.001 as indicated by the bars. ANOVA followed by paired t -test with Bonferroni's correction; (B) Representative blot of Bim EL , Bim L and Bim S protein isoform expression (n = 6); (C) Densitometry of Bim S normalized by the housekeeping protein α-tubulin. are means ± SEM (n = 6) * P <0.05 or ** P <0.01 vs . siCTL, # P <0.05 vs . siGLIS3 by paired t -test.

Journal: PLoS Genetics

Article Title: GLIS3 , a Susceptibility Gene for Type 1 and Type 2 Diabetes, Modulates Pancreatic Beta Cell Apoptosis via Regulation of a Splice Variant of the BH3-Only Protein Bim

doi: 10.1371/journal.pgen.1003532

Figure Lengend Snippet: INS-1E cells transfected with control or GLIS3 siRNA were exposed to forskolin (20 µM) and/or cytokines for 24 h. After this period apoptosis was measured using nuclear dyes. (A) Apoptosis induced by cytokine treatment after siRNA transfection and forskolin exposure. are means ± SEM (n = 6) * P <0.05 or *** P <0.001 vs . siCTL without forskolin; ### P <0.001 vs . siGLIS3 without forskolin; %% P <0.01 vs . siCTL with forskolin; @@@ P <0.001 vs . siGLIS3 with forskolin; $ P <0.05, $$ P <0.01, $$$ P <0.001 as indicated by the bars. ANOVA followed by paired t -test with Bonferroni's correction; (B) Representative blot of Bim EL , Bim L and Bim S protein isoform expression (n = 6); (C) Densitometry of Bim S normalized by the housekeeping protein α-tubulin. are means ± SEM (n = 6) * P <0.05 or ** P <0.01 vs . siCTL, # P <0.05 vs . siGLIS3 by paired t -test.

Article Snippet: To express GLIS3 in insulin-secreting cells, we obtained from SIRION Biotech (Munich, Germany) a recombinant adenovirus comprising fragments of the mouse GLIS3 mRNA (GenBank: NM_175459).

Techniques: Transfection, Control, Expressing